1. #981

    Re: Easter Eggs

    I don't know if this has been done yet, but the DNA given is a match for Homo Sapiens Chromosomes 12, 17, 2, and 16 as well as Homo sapiens sodium channel, nonvoltage-gated 1 alpha.

    However, I think its more likely that they just typed up a random sequence of nucleotides.
    Share this post

  2. #982
    kobe745's Avatar Senior Member
    Join Date
    Mar 2014
    Posts
    502

    Re: Easter Eggs

    Originally Posted by FatShady
    In ANBA's interview, he said the following:

    "If there would be ultimate secret code, something like to live, to err, to fall, to triumph, to recreate life out of life… would be cool."

    I suggest you watch this, in relation to the above comment

    http://www.ted.com/talks/craig_vente...etic_life.html

    It is a presentation that details how they used DNA (AGCT) to create their own cipher used to store words, names and even websites within DNA. I think it holds the key to unlocking the DNA sequence.
    Hello guys,

    Little by little im making progress on the DNA easter egg. Just wanted to share that, just like Fatshady and others (?), i believe there might be a hidden message in this DNA code. The above movie shows how Dr. Craig Venter encoded a quote by James Joyce into a DNA sequence. This process is called DNA cryptography. Heres an easy to read article on the subject: http://www.technologyreview.com/blog/arxiv/23167/
    If, for example, A=00 / C=01 / G=10 / T=11 someone could translate a dna sequence into binary.

    A more complex DNA encoding system can be found here: http://www.technologyreview.com/blog/arxiv/23167/ Dr Bok used cryptography to embed his poem into the genetics of the bacterium, devising a chemical alphabet in which each letter is represented by a specific triplet of nucleotides. So, for example, the nucleotide sequence "ATA" codes for the letter "y" and GTG stands for the letter "n"...
    Share this post

  3. #983
    JoeRegular's Avatar Senior Member
    Join Date
    Mar 2014
    Posts
    1,886

    Re: Easter Eggs

    Both those links go to the same place Kobe. Interesting read though

    Anba's clue along with Shady's find seem to almost definitely point to something being encoded in the DNA sequence.
    Share this post

  4. #984

    Re: Easter Eggs

    Full vid of Kubricks Boxes

    http://vimeo.com/25746412

    Watching it, and mind blown at 8:50. This may already been talked about but first i heard of it.
    Share this post

  5. #985

    Re: Easter Eggs

    Originally Posted by ender3
    Full vid of Kubricks Boxes

    http://vimeo.com/25746412

    Watching it, and mind blown at 8:50. This may already been talked about but first i heard of it.
    Sorry if we didn't share this mate. Kobe and I 'acquired' a copy of this video last week and we both watched it... When you watch this video, all the box clues make sense.

    For those not sure what we are talking about, the 6.2m panorama that was in FlipTaco's box was the exact same thing that Stanley Kubrick had a photographer do... really interesting documentary. When you see the SKA788 box right at the end, it just makes you smile!
    Share this post

  6. #986
    kobe745's Avatar Senior Member
    Join Date
    Mar 2014
    Posts
    502

    Re: Easter Eggs

    Heres a full list of the secret messages encoded into the Craig Venter DNA, It also shows the ACGT strings corresponding to the messages. I noticed theres also a Stephen Hawkings (The universe in a nutshell) reference coded in the DNA. I remember one of you guys mentioning him earlier on: did you pick up this book aswell?

    http://singularityhub.com/2010/05/24...ed-in-its-dna/
    Share this post

  7. #987

    Re: Easter Eggs

    Originally Posted by kobe745
    Heres a full list of the secret messages encoded into the Craig Venter DNA, It also shows the ACGT strings corresponding to the messages. I noticed theres also a Stephen Hawkings (The universe in a nutshell) reference coded in the DNA. I remember one of you guys mentioning him earlier on: did you pick up this book aswell?

    http://singularityhub.com/2010/05/24...ed-in-its-dna/
    OK, If we are working on the DNA code, then I should share my work. I still have not figured it out yet but here is what I know. You are right about DNA Cryptography. It seems that this has gained momentum as s way to hide messages. I think that the James Joyce quote is certainly a reference to the DNA clue and the work of Craig Venter. One thing to remember however is the timeline that is involved here.

    The James Joyce quote was actually included in the DNA code from a project that was only announced publicly in 2010. The method used to encode the 2010 DNA was rather complex using a system that had 64 characters (letters, numbers and symbols). While we all can see what the other codes were in the 2010 DNA from Kobe's article posting, what you can see is the code cracked.

    I found an interesting article on someones blog that cracked the code from 2010.

    Here is a link http://maryparlange.blogspot.com/201...atermarks.html

    As you can see, he was able to crack the code and explains how. My issue is, while this is cool, this is the complex code used in 2010 after the BIG PACK was released. As a result, the complex codes used here are likely to be irrelevent.

    In 2008 however, at a time when ANBA could have known about this, the code used by Craig Venter was much simpler

    Here is the quote from Kobes article again

    This isn’t the first time that JCVI has been marking its territory. Back in 2008 when they were still working on getting a bacteria genome assembled they used the four ‘letters’ of DNA (G,A,T,C) to scribble a few words into its genetic code. These messages used codons, groups of three letters which code for amino acids, to stand for 20 letters of the alphabet. As such, some substitutions (like ‘v’ for ‘u’) were necessary. The results were relatively simple but still pretty cool:
    CRAIGVENTER coded as:
    TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAAC TAGCTAA
    VENTERINSTITVTE coded as:
    TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGT GACTGAGTTAACTAGCTAA
    HAMSMITH coded as:
    TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA
    CINDIANDCLYDE coded as:
    TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGA ATTAACTAGCTAATGGGTC
    GATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGC CCTAAAACAAAGTTAAACATCATG
    GLASSANDCLYDE coded as:
    TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGA G TTAACTAGCTAA


    This code should have been available in 2008 so when the DNA sequence was placed in the game, it could have either used this code, or something else? I have not been able to find a solution for this code yet.

    As I understand it, it works like this:

    At the start of a word are a set of letters, indicating that this contains code. In this case

    TTA ACT AGC TAA

    This stands for LTS*. You will see it at the start and end of each of these. My issue is that we have 40 letters, and this number is NOT divisible by 3. All DNA codes that I looked at, including Craig Venters ones, used 3 letters at a time.

    So then I looked around, as Kobe again pointed out, that you can convert DNA to binary. Using (A for 00, C for 01, G for 10, T for 11), I decoded this message again:

    C C G G C C A G C G G C C G G G C T C C C C A G C C A C G C C C C T G C A C C T
    01011010010100100110100101101010011101010101001001 010001100101010111100100010111

    The result is "ZRijuRQy" which again means nothing.

    Finally, I found a website that made DNA codes for you and tried to get something out of it with no luck either See here: http://www.thinkbiotech.com/DNA-o-gram/

    At the end of all this I am no closer to solving it. I think that the Venter clue is suggesting that there is a hidden message in the DNA for sure. Perhaps that is ALL the venter clue is telling us. We just need to figure out what the code is and crack it.

    Perhaps ANBA made his own code that only had 2 letters (so that 40 letters would evenly divide.

    For example

    CT = A
    GT = B
    AC = C

    I doubt this could work as it would only result in 16 letters. (don't trust my maths here)

    Perhaps he could have used 4 letters

    AAAA = A
    AAAC = B

    or something like that, but again this would just be a massive list (256?) of possible combinations.

    I still think that he used an existing form of encryption to make the code, but just not sure which one. Hope that helped... Not sure if this was worth writing, but I have worked on this since before the Kotaku Article was published with no luck.
    Share this post

  8. #988
    kobe745's Avatar Senior Member
    Join Date
    Mar 2014
    Posts
    502

    Re: Easter Eggs

    The most common used technique would be to translate the DNA-codons into the corresponding aminoacid http://www.cbs.dtu.dk/courses/27619/codon.html

    As Fatshady stated this cant be done since 40 cant be divided by 3! The original easter egg however shows 6 identical signs, so that 6*40=240 /3 = 80. Although the signs are identical, if we place them behind eachother it will result in groups of unique dna-codons. So we have a possible 80 character code here in wich we should first try to identify a startcodon (http://en.wikipedia.org/wiki/Start_codon ) and stop codon (http://en.wikipedia.org/wiki/Stop_codon).

    This might result in nothing, but its worth a try right? Its a long code and mistakes can easily be made; if anyone feals like double cheking that would be cool. Have you tought of this yet Fatshady?
    Share this post

  9. #989

    Re: Easter Eggs

    Originally Posted by kobe745
    The most common used technique would be to translate the DNA-codons into the corresponding aminoacid http://www.cbs.dtu.dk/courses/27619/codon.html

    As Fatshady stated this cant be done since 40 cant be divided by 3! The original easter egg however shows 6 identical signs, so that 6*40=240 /3 = 80. Although the signs are identical, if we place them behind eachother it will result in groups of unique dna-codons. So we have a possible 80 character code here in wich we should first try to identify a startcodon (http://en.wikipedia.org/wiki/Start_codon ) and stop codon (http://en.wikipedia.org/wiki/Stop_codon).

    This might result in nothing, but its worth a try right? Its a long code and mistakes can easily be made; if anyone feals like double cheking that would be cool. Have you tought of this yet Fatshady?
    No i hadn't thought of it tbh. Im not sure that would work. Your maths is right but as the 6 are identical, I think we need to only be looking at one?

    I would LOVE ANBA to come on here and at least provide the actual exact text from the signs, as I am worried that some letters in the middle are not clear.

    Apart from that, im not sure. There is not enough code here to allow us to crack it so there must be a way to do it..... Try your way mate, I may be wrong..
    Share this post

  10. #990
    JoeRegular's Avatar Senior Member
    Join Date
    Mar 2014
    Posts
    1,886

    Re: Easter Eggs

    Guys this is exactly the type of stuff I feared would go over my head

    It does sound like a very promising line of enquiry though.
    Share this post