Trials HD Easter Eggs | Forums

[RedLynxANBA]

e was just missing.. its visible here:
<!-- l --><a class="postlink-local" href="http://www.redlynxgame.com/forum/viewtopic.php?f=28&t=2667">viewtopic.php?f=28&t=26 67</a><!-- l -->

[rlmergeuser]

am i being blind, or does everyone else still not see E?

[rlmergeuser]

would this be it

[SuperRadioCase]

I bet E is short for Everything

[rlmergeuser]

I think the 40 letters read: CCGGCCAGCGGGCGGGCTCCCCAGCCAGGCCGCTGCACCT

I have only just jumped on this thread now but I immediately recognise this as DNA sequencing. I ahve no idea why buy the letters

A = adenine
C = cytosine
G = guanine
T = thymine

Reference:
http://en.wikipedia.org/wiki/DNA_sequence

These are the 4 basic building block of DNA (For those who are interested, Deoxyribonucleic acid)

seeing that i've just had a biology lesson on this stuff, i might be able to help crack some code they've got (or waist a bunch of time).

first a little background, so you'll understand what i'm going on about.

as i'm sure you know, DNA is made of two strands, with those letters representing the 4 different bases that bond the twe strands together

A bonds to G with 3 covailant bonds
A-G

C bonds to T with two covailant bonds
C-T


To start make protiens, the DNA unzips itself (making two seperate strands) and then mRNA is made out of the corresponding bases to the first strand.
ie. if the first strand of the DNA was AAA, then the mRNA would be GGG.

there is one slight difference between mRNA and DNA - the T is substituted with a U, so if the DNA was CCC, then the mRNA would be UUU.


the reanson i put that info, is because that code is very likely to represent some chain of protiens that mean something, but i only have the list of what protiens come from which combination of bases for the mRNA, and the sign in the game is coding for DNA.

so if we translate that into mRNA code we get:
UUAAUUGAUAAAUAAAUCUUUUGAUUGAAUUAUCATGUUC

this can be converted into the list of protiens that would be made from the sequence.

there are three more things you will need to know before you start:
- the protien is coded by a combination of 3 letters, so UUA would be the first protien, then AUU, etc.#
- AUG is the 'start' protien (which is Methionine), but since i cant see this, they might not have bothered with it
- UAA, UAG and UGG are stop protiens (which i dont have the proper name of), but again, there are many of these, so i dont think they took that into account

here is a chart to find which protien comes from what string:
http://citnews.unl.edu/croptechnolog.../960324911.gif
there is one mistake in the table (according to what is on my Bio homework, and the 'ile' is suppost to be 'iso'

and here is a much less clear table (in the same format) with their full names:
http://library.thinkquest.org/20465/table.html

have fun decoding it guys - i have much more important things to be getting on with now (like revision for Further maths exam on monday).

ps. i'm sorry if this turns out to be a waist of time, but its worth a go to try and unravel the trials mystery

[rlmergeuser]

I did this in Photoshop seems to read "de divina proportione" Google it

[rlmergeuser]

I did this in Photoshop seems to read "de divina proportione" Google it

I think you're onto something here. When I googled it, I found a reference to a "golden rectangle", and this image http://img37.imagefra.me/img/img37/2...4m_fec1853.jpg looks like a golden rectangle.

[SuperRadioCase]

I did this in Photoshop seems to read "de divina proportione" Google it

I think you're onto something here. When I googled it, I found a reference to a "golden rectangle", and this image http://img37.imagefra.me/img/img37/2...4m_fec1853.jpg looks like a golden rectangle.

We found this out somewhere back on page 4:

The two signs are definitely related.

Take a look. I adjusted the alignment with some spacing to make it obvious, and the "I" in the first sign is actually a "T":

_ED_V__APR___RT___E
D__I _IN___OPO__ION_

DEDIVINAPROPORTIONE

DE DIVINA PROPORTIONE

This translates to "On the Divine Proportion" a manuscript by Luca Pacioli which concerns mathematical proportion and the golden ratio (which has shown up several other places).

I still don't understand how this has to do with Trials but I'm sure it will make sense eventually

[MurdocLoch]

golden ratio theory:

As a level designer I have found that the size and ratios of all the items are scarily relative to each other. Sometimes I'm shocked at how perfectly the spacing and distances translates to the physics of the rider. I.E. The items are not only relative to each other but they also are relative to how the rider reacts to them. The items used to build the levels are in the golden ratio - planks three different sizes, each half as big as the next size up, and so on...

Obtaining this balance must not have been easy, a fact that apparently the developers are rather proud of and thus the easter eggs.

[rlmergeuser]

seeing that i cant find it while glancing over wiki, i'll tell you that, as far as i knew before going on wiki, the golden ratio was found by dividing the higher number of two adjacent numbers in the fibbonacci series with the lower. and the further along the series you go, the more accurate it gets

for those that dont know, the fibbonacci series is just the sum of the previous two digits, starting with two 1's.
ie: 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, etc.
this is where those squares in a spiral come from first two are 1x1 squares, then 2x2, then 3x3, then 5x5, etc

so the 1st estimate of the golden ratio is 1/1 = 1
2nd is 2/1 = 2
3rd is 3/2 = 1.5
then 1.6666666 reccuring
1.6
1.625
1.615384.....
1.61904.....
1.617647....
etc

this gets closer and closer to the number quoted on wiki (1.6180339887).

as to its significance, you know as much as me.