I know exactly what you mean, I had a quick look around today and just gave up! It's best to leave it to the proffesionalsOriginally Posted by FlipTacoAs am I, I've looked endlessly through each possible level they could be on and I've turned up nothing. He could narrow it down to a single level and I'd still have major issues finding itOriginally Posted by pahaperttiI'm amazed at how LostNr is able to find some of these hard to find easter eggs.
I would like to see a complete list of the Easter Eggs though.
Senior Member
Edit: Here's a list with every known easter egg and every known level which they come from. There's no way I could write a guide for all of this seeing how massive this list isOriginally Posted by MellarI know exactly what you mean, I had a quick look around today and just gave up! It's best to leave it to the proffesionalsOriginally Posted by FlipTacoAs am I, I've looked endlessly through each possible level they could be on and I've turned up nothing. He could narrow it down to a single level and I'd still have major issues finding itOriginally Posted by pahaperttiI'm amazed at how LostNr is able to find some of these hard to find easter eggs.
I would like to see a complete list of the Easter Eggs though.
(Now separated by difficulty, skill games and unknown stuff to unclutter the list)
Non-DLC easter eggs:
Beginner:
- The Fibonacci pattern in Middle Name: Danger
Easy:
- The hunter and deer cave drawing in Mother of all Jumps
Medium:
- The small explosive zone just under the loop in Where's the Ground
- The "crash" in Stock Market
- 42 in Stock Market
- The room behind the start of Rock'n'Drop with explosives covering the ground
- The bowling alley in Jolly Jumper
Skill:
- The binary code in Infernal Pinball (no important meaning, it translates to "Y", indicating that the player will get no higher without ejecting)
Unknown:
- E, accursed E... we will find you yet :/
DLC easter eggs:
Medium:
- The Deal or No Deal crates in Workshop of Secrets
- The squirrel behind and above the elevator in Workshop of Secrets
- The yellow 1-1 sign in Where's the Sky
- The lowrider in Dangerous Ride
- The squirrel followed by the 1452 sign in Dangerous Ride
- The letter sign in Speed Trap
- The top-hat guy in 1 Bit Trip
- The giant squirrel/truck with an acorn in 1 Bit Trip
- The boy and his dog under the finish in 1 Bit Trip
- The Fibonacci sign in Condemned Complex
- Orion in Space Station (by the way, c-c-c-combo breaker!)
- The roman numeral sign in Fantastic
- The waste disposal in Pipe Network
Hard:
- The defensive tree in Wheels of Misfortune
- The squirrel in Smelting Hazard
- The cardboard box "display" in Junkyard
- The squirrel ambush in Big Rig Drilling
- The ninja course underneath Skyway
- The cardboard box in Smoke and Mirrors
- The binary sign in Donkey Business
- The shy squirrel in Isabelle
Extreme:
- The map of the word, apparently before the discovery of the American continents, in Diabolic
Skill:
- The second cardboard box "display" underneath Ski Jump
- The mammoth at the end of Pain! Again!
- If anybody had the talent to reach that high up afterburner at the end of Turbo Flip, I'm sure it would lead somewhere
- The scary squirrel shadow in Extreme Torque
LostNr's personal collection:
- DaVinci's unfinished machine
- The DNA code sign
I'll update that list as more secrets are found and more locations are revealed by Lost. Not a bad use for my 300th post, eh?
Senior Member
Can you please confirm the details of the DNA sequence. Which track, is there any other related information about this.
I have spent a couple of hours and the only thing I can find is that of this 40 character string, it seems to actually be 2 X 20 base pairs (not sure if human or otherwise but humans or otherwise?actually have no idea about genetics but I was looking for any paterns). I noticed that a number of mutations of DNA (http://en.wikipedia.org/wiki/List_of..._polymorphisms) for example had 20 char strings.
The 2 X 20 strings are not related (ie they are not the opposites of each other.
in simple terms, C is paired with G, A is paired with T
In excel i did this where A1 was the first of the 40 char's;
=IF(A1="C","G",IF(A1="G","C",IF(A1="A","T",IF(A1=" T","A",""))))
just to get the oposites mapped out, however this proved to be useless as I have NO IDEA what any of this means.
These strings do not seem to come up anywhere that i could find but the letters and the length of the strings do fit the pattern of a specific DNA sequence. If anyone else is able to contribute be my guest. (Any geneticists in here?)
Cheers,
What is all this talk of "E"? Is that just talking about the "credits" section of the menu? At the end there is alot of talking...some relating to some Greek philosopher, im sure you all must have the game so go read it yourself!!
Wow, thanks for the listOriginally Posted by FlipTacoI'll update that list as more secrets are found and more locations are revealed by Lost. Not a bad use for my 300th post, eh?
Senior Member
So, Lost, I understand you're still holding out on us...
Good job on the list, FlipTaco.
You might want to add:
"The full text that was hidden in trailers were:
Jinrcp'c wuoir lvcodcc gyvq rri pkkc, K fjygioh nkxf kpqy sdpipc ksshyxgc"
and the upside-down area on the ceiling with the car and barrels on Greatest Hits.
I too wonder what's the deal with the almost unreachable afterburner at the end of Turbo Flip. Has to be there for a reason because you really can't get there by accident ...
However, I'm pretty certain when it comes to the way of reaching the afterburner. Marvel at my artistic skills:
But not too sure ...
And I guess it's time for some hints:
Workshop / Atelier:
It's on a DLC track
It's NOT on an extreme difficulty track
You can get there by bike
It's NOT on the first 3 tracks of both medium/hard
DNA Sequence:
It's on a DLC track
It's NOT on an extreme difficulty track
You can get there by bike
It's NOT on the first 3 tracks of both medium/hard
New: They're NOT on Epic Jumps, 1 Bit Trip, Condemned Complex, Space Station, Skyway, Donkey Business, Isabelle.
I'll continue to post additional hints on where and how to find them after a while.
Not sure if this counts but after finishing 1 bit trip I fell donw and could see a man with a dog that I hadnt seen before today.
Senior Member
Yep, that's on my list. He also has a pixelated ball , tooOriginally Posted by Pootrain5
Edit: I could've sworn I edited this post with all of the content from my last post. Whoops
Senior Member
So we've got Pro Speedway, Speed Trap, Final Flashback, Fantastic, Pipe Network, Wheels of Misfortune, Smelting Hazard, Junkyard, Big Rig Drilling, Smoke and Mirrors, and Prison Break. Now, considering that each level seems to have one exclusive easter egg, you're left with Pro Speedway, Final Flashback, and Prison Break. Time to start looking againOriginally Posted by LostNrGood job on the list, FlipTaco.
You might want to add:
"The full text that was hidden in trailers were:
Jinrcp'c wuoir lvcodcc gyvq rri pkkc, K fjygioh nkxf kpqy sdpipc ksshyxgc"
and the upside-down area on the ceiling with the car and barrels on Greatest Hits.
I too wonder what's the deal with the almost unreachable afterburner at the end of Turbo Flip. Has to be there for a reason because you really can't get there by accident ...
However, I'm pretty certain when it comes to the way of reaching the afterburner. Marvel at my artistic skills:
But not too sure ...
And I guess it's time for some hints:
Workshop / Atelier:
It's on a DLC track
It's NOT on an extreme difficulty track
You can get there by bike
It's NOT on the first 3 tracks of both medium/hard
DNA Sequence:
It's on a DLC track
It's NOT on an extreme difficulty track
You can get there by bike
It's NOT on the first 3 tracks of both medium/hard
New: They're NOT on Epic Jumps, 1 Bit Trip, Condemned Complex, Space Station, Skyway, Donkey Business, Isabelle.
I'll continue to post additional hints on where and how to find them after a while.
I also noticed that ramp up there as well, but I still can't get a large enough jump to reach the afterburner even after using the ramp. There's nothing else there, though, so that ramp has to be involved somehow :/
Edit: HAHA, I knew that annoying square log on Pro Speedway had to do with something! It has the only open gap in the platform so I knew there was something to it and I found it:
SUPPORT FULL DISCLOSURE, DON'T KEEP SECRETS
From the start, go down the hill, then climb the next hill, then drop to the bottom of the next hill. Drive forward until you reach a checkpoint just behind a square log and a wooden plank. Put your front wheel just over the square log then back up. You'll end up knocking a now physics-enabled log off of the track. Fall down and reverse until victory.
Edit 2: Needs more victory!
CCGGCCAGCGGCCGGCCTCCCCAGCCACGCCCCTGCACCT - Maybe it's squirrel DNA?
In Prison Break, get to the part with the roof lamps and the cafeteria/table area. Hop on the lamps and get to the second lamp. Drive forward slowly and when you see the light in the background fall over, back off of the lamp, land on the tables, and go the the back of the room. You should see that the floor has dropped away; enter the hole, drive forward, more victory. The main reason I noticed this is because I checked the back of the table room earlier and noticed the cracks in the floor, as compared to the rest of the floor that was one solid piece.
Edit 3: I just noticed that if you bail out on the first big jump on Epic Jumps, you'll notice a large, open, default area similar to Under Ground. However, there's one block added in to prevent anybody who makes it there from continuing forward. Lol, RedLynx
Also, the only level left without an easter egg found is Final Flashback. I bet you anything there's something there
