Senior Member
The purpose of the interview Anba gave was to hint what the question to the riddle was. The hitchhikers guide to the galaxy points directly towards a question, there where alice in wonderland doesnt. You are correct in that adams was inspired by carroll when he wrote his book, but i dont think this proves that we should be looking into him all of the sudden.Originally Posted by wmgeek
Anba also made a reference to Lost pointing out, as fatshady mentioned, that the easter egg 42 is important when looking for the question.
What im trying to say is that 42 must be important for the question, this is the clue Anba is giving in the interview. 42 can be linked to many things (as you can see in this wikipage. However, it only once directly points towards a question, wich is that of the hitchhikers guide.
If your looking for clues that point to questions 42 is not the only one, tho the other clues do lead to more specific questions
da vincis' wing = how do birds fly
darwins tree = how did the myriad of species on earth come to exist
roanoke = what happened to the lost colony
tunguska = what caused it?
...42 is not the only clue that points to a question...
Senior Member
i think your missing the point. Anba interview was announced to give us a clue about the question. The only clue to be found in the interview is 42. He didnt hint tunguska, or darwin tree... he only hinted 42Originally Posted by wmgeek
Sorry, I worded that wrong. By anythng I meant anything that satisfies X in the equation 42 = XOriginally Posted by kobe745
Senior Member
Imo, the Joyce quote is definitely the key to the DNA easter egg.
http://singularityhub.com/2010/05/24/venters-newest-synthetic-bacteria-has-secret-messages-coded-in-its-dna/
In the above article, Joyce's quote was encoded into the DNA of a bacteria by using a substitution system with each group of three base pairs. So surely the DNA easter egg decodes to something. It seems to be the clearest easter egg to me and if we could get something out of it, it might just be the toehold we need to make everything else easier.
So after looking into it a bit I found this
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1904243/table/T1/
Now perhaps this is not the correct substitution key but I think it may be worth looking along these lines. Im convinced there is plaintext hidden in that DNA sequence. As you can see, if you break each section of the DNA sequence into triplets you get this,
CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT
CCG-GCC-AGC-GGC-CGG-GCT-CCC-CAG-CCA-CGC-CCC-TGC-ACC-T
W | - | - | E | - | - | - | - | B | H | - | L | 1 | T
From this we get: WEBHL1T
Now, I have no idea what this means or if it means anything at all but I found it funny because I really thought I was onto a winner when the first three letters were: WEB
Senior Member
I spent soooo many hours on this one and basically got to where you are at now. Glad im not alone. That whole code cracking/cipher stuff was really interesting though. Sorry I can't help more, I have seriously done all I could do.Originally Posted by NonRedOrchidImo, the Joyce quote is definitely the key to the DNA easter egg.
http://singularityhub.com/2010/05/24...ed-in-its-dna/
In the above article, Joyce's quote was encoded into the DNA of a bacteria by using a substitution system with each group of three base pairs. So surely the DNA easter egg decodes to something. It seems to be the clearest easter egg to me and if we could get something out of it, it might just be the toehold we need to make everything else easier.
So after looking into it a bit I found this
http://www.ncbi.nlm.nih.gov/pmc/arti...4243/table/T1/
Now perhaps this is not the correct substitution key but I think it may be worth looking along these lines. Im convinced there is plaintext hidden in that DNA sequence. As you can see, if you break each section of the DNA sequence into triplets you get this,
CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT
CCG-GCC-AGC-GGC-CGG-GCT-CCC-CAG-CCA-CGC-CCC-TGC-ACC-T
W | - | - | E | - | - | - | - | B | H | - | L | 1 | T
From this we get: WEBHL1T
Now, I have no idea what this means or if it means anything at all but I found it funny because I really thought I was onto a winner when the first three letters were: WEB
There is only one thing that was stopping me. If the DNA letters are arranged in groups of three, then this can't be a code because the number of letters is not divisible by three (as you can see with the left over letter)... that is actually why I stopped.
how many dna signs are there?? and if you multiply the number of letters by the number of signs is the end number divisible by three??
if the number of signs is a multiple of three you'll have enough 3 digit codons to get a full message
Senior Member
Like Shady I also spent ages working on this but to no avail. One thing I haven't tried is to add 2 extra letters to make it up to a number that is divisable by 3 (42). It wouldn't take long as there are not many possible combinations -I just never got round to it. If someone wants to have a go be my guest. I'm far to busy at work.
there are six dna plaques either on the wall or having fallen off.... according to the pics back on page 6 or 7 of the thread...
...with 40 characters on each plaque that gives you a total of 240 characters... which gives you 80 triplets...
1)CCG- 2)GCC- 3)AGC- 4)GGC- 5)CGG- 6)GCT- 7)CCC-CAG- 9)CCA- 10)CGC- 11)CCC- 12)TGC- 13)ACC-
14)TCC- 15)GGC- 16)CAG- 17)CGG- 18)CCG- 19)GGC- 20)TCC- 21)CCA- 22)GCC- 23)ACG- 24)CCC- 25)CTG
26)CAC- 27)CTC- 28)CGG- 29)CCA- 30)GCG- 31)GCC- 32)GGG- 33)CTC- 34)CCC- 35)AGC- 36)CAC- 37)GCC
38)CCT- 39)GCA- 40)CCT- 41)CCG- 42)GCC- 43)AGC- 44)GGC- 45)CGG- 46)GCT- 47)CCC- 48)CAG- 49)CCA
50) CGC- 51)CCC- 52)TGC- 53)ACC- 54)TCC- 55)GGC- 56)CAG- 57)CGG- 58)CCG- 59)GGC- 60)TCC- 61)CCA
62)GCC- 63)ACG- 64)CCC- 65)CTG- 66)CAC- 67)CTC- 68)CGG- 69)CCA- 70)GCG- 71)GCC- 72)GGG- 73)CTC
74)CCC- 75)AGC- 76)CAC- 77)GCC- 78)CCT- 79)GCA- 80)CCT
which using the code table NonRedOrchid gave us is -
1)W 2)- 3)- 4)E 5)- 6): 7)-
14)M 15)E 16)- 17)- 18)W 19)E 20)M 21)B 22)- 23)S 24)- 25)U
26)- 27)- 28)- 29)B 30)9 31)- 32)- 33)- 34)- 35)- 36)- 37)
38)V 39)3 40)V 41)W 42)- 43)- 44)E 45)- 46): 47)- 48)- 49)B
50)H 51)- 52)L 53)1 54)M 55)E 56)- 57)- 58)W 59)E 60)M 61)B
62)- 63)S 64)- 65)U 66)- 67)- 68)- 69)B 70)9 71)- 72)- 73)
74)- 75)- 76)- 77)- 78)V 79)3 80)V
after goin through this i realised the second set of forty triplets just repeats the first...there's definitely something here...i dont think the code table provided by orchid is the correct one for us...i think we just have to find the right substitution of letters for triplets
Senior Member
Ive actually been through this idea before (never shared it as ive not got anywhere)...Originally Posted by wmgeekthere are six dna plaques either on the wall or having fallen off.... according to the pics back on page 6 or 7 of the thread...
...with 40 characters on each plaque that gives you a total of 240 characters... which gives you 80 triplets...
1)CCG- 2)GCC- 3)AGC- 4)GGC- 5)CGG- 6)GCT- 7)CCC-
14)TCC- 15)GGC- 16)CAG- 17)CGG- 18)CCG- 19)GGC- 20)TCC- 21)CCA- 22)GCC- 23)ACG- 24)CCC- 25)CTG
26)CAC- 27)CTC- 28)CGG- 29)CCA- 30)GCG- 31)GCC- 32)GGG- 33)CTC- 34)CCC- 35)AGC- 36)CAC- 37)GCC
38)CCT- 39)GCA- 40)CCT- 41)CCG- 42)GCC- 43)AGC- 44)GGC- 45)CGG- 46)GCT- 47)CCC- 48)CAG- 49)CCA
50) CGC- 51)CCC- 52)TGC- 53)ACC- 54)TCC- 55)GGC- 56)CAG- 57)CGG- 58)CCG- 59)GGC- 60)TCC- 61)CCA
62)GCC- 63)ACG- 64)CCC- 65)CTG- 66)CAC- 67)CTC- 68)CGG- 69)CCA- 70)GCG- 71)GCC- 72)GGG- 73)CTC
74)CCC- 75)AGC- 76)CAC- 77)GCC- 78)CCT- 79)GCA- 80)CCT
which using the code table NonRedOrchid gave us is -
1)W 2)- 3)- 4)E 5)- 6): 7)-
14)M 15)E 16)- 17)- 18)W 19)E 20)M 21)B 22)- 23)S 24)- 25)U
26)- 27)- 28)- 29)B 30)9 31)- 32)- 33)- 34)- 35)- 36)- 37)
38)V 39)3 40)V 41)W 42)- 43)- 44)E 45)- 46): 47)- 48)- 49)B
50)H 51)- 52)L 53)1 54)M 55)E 56)- 57)- 58)W 59)E 60)M 61)B
62)- 63)S 64)- 65)U 66)- 67)- 68)- 69)B 70)9 71)- 72)- 73)
74)- 75)- 76)- 77)- 78)V 79)3 80)V
after goin through this i realised the second set of forty triplets just repeats the first...there's definitely something here...i dont think the code table provided by orchid is the correct one for us...i think we just have to find the right substitution of letters for triplets
The issue you have is that while the 6 signs are then divisible by 3, they are all the same sign. so even if there is a message, this will be the same thing repeated 6 times...
As a result, I dont thik this will reveal anything. If we were missing the last letter, then I would agree totally, but we are not getting anything.
The more aI think about it, cracking a cipher would require either more and varied letters such as in the Craig Venter example, or it would require a key of some sort. Neither of which are present.
As a result, I tend to think that, as many people have pointed out, that this is certainly human DNAthink some guys found the particular protien or something). Perhaps it is more to do with that than actually containing a code.
