Trials HD Easter Eggs | Forums

[lespritdelescal]

Maybe some invention from Leonardo Da Vinci? It looks a little like a wing from that flying machine of him.

That's what I've been thinking since I saw it, but the wings of his flying machines look a bit different.

EDIT: Grr... all this morning, I've been having troubles with messages on this board. In this thread, the last 10 messages didn't load, and I only saw them after I posted my reply. Happened in another thread I was looking at too.

[SuperRadioCase]

So, anybody beside me already found the eight-barrelled gun/rake? FlipTaco? Anybody?

Nope, I've looked through every level I thought may be hiding that rake but nope, I haven't gotten anything. Is it can be hint now?

[rlmergeuser]

Itz can haz hint:

It's on a DLC track
It's NOT on an extreme difficulty track

I'll continue to post additional hints on where and how to find it if it doesn't get found

[rlmergeuser]

http://www.tineye.com/search/7252b65...da59e7ad7b6ec0 is this a new one? i dont recall seeing it on here yet, and also, im not too sure how to get a picture on here. this was on Where's the sky, on the last "loop" (shown in track preview) land on the container, and go forward to knock the things outta the way, the camera will rotate to show this. Apparently i dont know how to post pics. you can right click on the "broken link" and load in new tab.
ITS ALREADY BEEN POSTED, SORRY ON PAGE 1 but still worth another look!

[rlmergeuser]

Yes jasonf1083, I posted a pic on a previous page.

[rlmergeuser]

[quote="LostNr"]Here's what I've discovered so far:


???:





this could be a fractal tree, i didnt read what one is, but they look similiar...im sure it has something to do with it. being it involves math. i dont know, i could be taking steps backward in getting this stuff all figured out.

[SuperRadioCase]

Itz can haz hint:

It's on a DLC track
It's NOT on an extreme difficulty track

I know that we've clarified that any remaining secrets, besides E, are found on the dlc, and that's only 2 tracks eliminated from the search. Greeeaaatttt

[rlmergeuser]

I know that we've clarified that any remaining secrets, besides E, are found on the dlc, [...]

Really? Where can I read about that? I must've missed it.

and that's only 2 tracks eliminated from the search. Greeeaaatttt

I know. Awesome - isn't it?
But that's why I said I'll continue to give clues if it wont be found.

Oh, and look at what I stumbled across:









I think the 40 letters read: CCGGCCAGCGGGCGGGCTCCCCAGCCAGGCCGCTGCACCT

[FatShady Live]

I think the 40 letters read: CCGGCCAGCGGGCGGGCTCCCCAGCCAGGCCGCTGCACCT

I have only just jumped on this thread now but I immediately recognise this as DNA sequencing. I ahve no idea why buy the letters

A = adenine
C = cytosine
G = guanine
T = thymine

Reference:
http://en.wikipedia.org/wiki/DNA_sequence

These are the 4 basic building block of DNA (For those who are interested, Deoxyribonucleic acid)

[rlmergeuser]

i spent 12 mins and nearly 100 faults going through the whole lot of smoke and mirrors on the micro donkey to see if there was any gaps or triggers in that vent or anywhere to squeeze into at the end but alas i found nothing, there has to be a big surprise in that level apart from the box, there has to be especially with a name like smoke and mirrors. Also spent ages trying to bail into the last box in workshop of secrets finally got it and it was just a sign that falls on you, if you ride backwards from up there though you get to see a squirrel in a box but im sure this has already been found by a million people.